View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19099_low_44 (Length: 219)
Name: NF19099_low_44
Description: NF19099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19099_low_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 167 - 201
Target Start/End: Complemental strand, 28265800 - 28265766
Alignment:
| Q |
167 |
atgaattgatgagcgttatttcatgagcatccttg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
28265800 |
atgaattgatgagcgttatttcatgagcatccttg |
28265766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 127
Target Start/End: Complemental strand, 5316112 - 5316040
Alignment:
| Q |
55 |
tggtaaggaaaattcggcgatttcttaaaattgattgggaggtgaaggtgtgtcactcttaccgtgaagcaag |
127 |
Q |
| |
|
|||| |||||||||| | |||| ||| || | ||||||||| ||||||||||||| ||||||| || |||||| |
|
|
| T |
5316112 |
tggtgaggaaaattctgtgattgcttgaattggattgggagatgaaggtgtgtcaatcttaccttggagcaag |
5316040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University