View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1909_high_5 (Length: 307)
Name: NF1909_high_5
Description: NF1909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1909_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 293
Target Start/End: Original strand, 6060930 - 6061222
Alignment:
| Q |
1 |
tgaaatctgcaggcctgtttaagatatttaatgttatccccatgaattatttaatcactgtctactattggatatagtttctttgagtaattctatgacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6060930 |
tgaaatctgcaggcctgtttaagatatttaatgttatccccatgaattatttaatcactgtctactattggatatagtttctttgagtaattctatgacc |
6061029 |
T |
 |
| Q |
101 |
aattgccctggaaaactagttttagtagaggggatgatcagtgcatgttgtattgcctgtgggatgttagatttgccctgttagtaaccagcagtttggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6061030 |
aattgccctggaaaactagttttagtagaggggatgatcagtgcatgttgtattgcctgtgggatgttagatttgctctgttagtaaccagcagtttggc |
6061129 |
T |
 |
| Q |
201 |
aatatacaacaaaattgggctaacaatttttccttgatgttaagcttgtagataatttgaatcattctcctgctgaccatgctaacaagaata |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6061130 |
aatatacaacaaaattgggctaacaatttttccttgatgttaagcttgtagataacttgaatcattctcctgctgaccatgctaacaagaata |
6061222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University