View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1909_high_9 (Length: 227)
Name: NF1909_high_9
Description: NF1909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1909_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 4 - 225
Target Start/End: Original strand, 44475516 - 44475740
Alignment:
| Q |
4 |
aaaattgtatcattgatcagaagttattttttcataaactacattgataagctta------atgtatctcg--attcatcaaagaatataatgatagcta |
95 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||| |||||||||||||| |||||||| |
|
|
| T |
44475516 |
aaaattgtatcattgatcagaagttgttttttcataaactacattgataagcttatgaatcatttatctcgcgattcatcaaagaat-----gatagcta |
44475610 |
T |
 |
| Q |
96 |
atgagtttctacatttatttggcgtcaaataacacatattgctttcgataaaccgatgacaatgttgatttgctgtannnnnnnctcaatcaaaccattc |
195 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44475611 |
atgagtttctgcatttatttagcgtcaaataacacatattgctttcgataaaccgatgacaatgttgatttgctgtatttttttctcaatcaaaccattc |
44475710 |
T |
 |
| Q |
196 |
agcccgtgtaattatttttcttcaactttg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44475711 |
agcccgtgtaattatttttcttcaactttg |
44475740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University