View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1909_low_9 (Length: 279)
Name: NF1909_low_9
Description: NF1909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1909_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-138; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 20 - 271
Target Start/End: Original strand, 7902466 - 7902717
Alignment:
| Q |
20 |
gaggttgatgctgtttatacaaaaccattcaccactcaggctatactaattgctcctggtcaaaccacaaacgttctggttcatgccaatcaagttgctg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7902466 |
gaggttgatgctgtttatacaaaaccattcaccactcaggctatactaattgctcctggtcaaaccacaaacgttctggttcatgccaatcaagttgctg |
7902565 |
T |
|
| Q |
120 |
gtaggtactttgtggccaccaaggcttttatggatgccccaattcaagttgacaacaaaactgctacagctatacttcaatacaaagacatcccaaacac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7902566 |
gtaggtactttgtggccaccaaggcttttatggatgccccaattcaagttgacaacaaaactgctacagctatacttcaatacaaagacatcccaaacac |
7902665 |
T |
|
| Q |
220 |
tgtccaacccatccttccacagttgccagctagcaatgacacaggttctgct |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7902666 |
tgtccaacccatccttccacagttgccagctagcaatgacacaggttttgct |
7902717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 23 - 96
Target Start/End: Original strand, 7892196 - 7892269
Alignment:
| Q |
23 |
gttgatgctgtttatacaaaaccattcaccactcaggctatactaattgctcctggtcaaaccacaaacgttct |
96 |
Q |
| |
|
|||||||| ||||| |||||||||||||| || || | || ||||||| |||||||||||||||||| ||||| |
|
|
| T |
7892196 |
gttgatgcagtttacacaaaaccattcacaacacaatccattctaattggtcctggtcaaaccacaaatgttct |
7892269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University