View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19102_low_4 (Length: 440)
Name: NF19102_low_4
Description: NF19102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19102_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 18 - 410
Target Start/End: Complemental strand, 47923107 - 47922715
Alignment:
| Q |
18 |
gtaacaaaggaacttgattgttcgttcgtgggttgattgctagaggtctattatcagattatatgctttctggtttgctaatcaaagaactatgtttttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
47923107 |
gtaacaaaggaacttgattgttcgttcgtgggttgattgctagaggtctattatcagattatatgcttattggtttgctaatcaaagaactatgattttg |
47923008 |
T |
|
| Q |
118 |
cttttagtttaacttctattagatcatatgctttttagtttgctagtaaaggcaatatgtctctcaaacagatgcctatcttgttttatgcttttttgtt |
217 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47923007 |
cttttagtttaacttctattagatcgtatgctttttagtttgctagtaaaggcaatatgtctctcaaacagatgcctatcttgttttatgcttttttgtt |
47922908 |
T |
|
| Q |
218 |
aagcttgattatgactatgactgtcttggcttgnnnnnnnnnnnnnnnnnnnnnnncggtcactaatgaatcgagagtgattattgatgggaaaagtacc |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47922907 |
aagcttgattatgactatgactgtcttggcttgttttttttctctttactttttttcggtcactaatgaatcgagagtgattattgatgggaaaagtacc |
47922808 |
T |
|
| Q |
318 |
aaaaagtatctagtatgaaccgcttgcttgttaaggtgcactagtttatgacacatttacaactactatcaacctgatgccgtaacagaacac |
410 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47922807 |
aaaaagtatctagtatgaaccgcttgcttgttaaggtgcactagtttatgacacatttacaactactatcaacctgatgccgtaacagaacac |
47922715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 57 - 148
Target Start/End: Complemental strand, 670484 - 670394
Alignment:
| Q |
57 |
ctagaggtctattatcagattatatgctttctggtttgctaatcaaagaactatgtt--tttgcttttagtttaacttctattagatcatatgc |
148 |
Q |
| |
|
|||||||||||||| ||||| |||||||| |||| ||||| |||||||||| | ||||||||||||||| |||||||||||| |||||| |
|
|
| T |
670484 |
ctagaggtctatta---gattacatgctttccagttttctaattaaagaactatatacgtttgcttttagtttaccttctattagattatatgc |
670394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 73 - 137
Target Start/End: Original strand, 28239768 - 28239832
Alignment:
| Q |
73 |
agattatatgctttctggtttgctaatcaaagaactatgtttttgcttttagtttaacttctatt |
137 |
Q |
| |
|
|||||| ||||||||| |||||||||| ||| ||| |||||||||||||| || ||||||||| |
|
|
| T |
28239768 |
agattacatgctttctagtttgctaatttaaggactttgtttttgcttttaattgcacttctatt |
28239832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University