View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_high_103 (Length: 273)
Name: NF19103_high_103
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_high_103 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 263
Target Start/End: Complemental strand, 27139650 - 27139408
Alignment:
| Q |
19 |
gatatttcactagtcagttccaataaagtatagaagactaaaacatacagctatatctagagaggttttgtgtaagactttgttgaaaattcaagtgagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27139650 |
gatatttcactagtcagttccaataaggtatagaagactaaaacgtacagctatatctagagaggttttgtgtaagact--gttgaaaattcaagtgagt |
27139553 |
T |
 |
| Q |
119 |
gacgaagttcgacattggttaataataggtttaataaaaacaatataagtgtaaaggcccatatactaaattactaatttccttaaggtttggagtcaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27139552 |
gacgaagttcgacattggttaataataggtttaataaaaacaatataagtgtaaaggcccatatactaaattactaatttccttaaggtttggagtcaag |
27139453 |
T |
 |
| Q |
219 |
ttatcgtgtcaagtctactattgtagtctgtcacttaggcctatg |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27139452 |
ttatcgtgtcaagtctactattgtagtctgtcacttaggcctatg |
27139408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University