View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19103_high_106 (Length: 271)

Name: NF19103_high_106
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19103_high_106
NF19103_high_106
[»] chr4 (2 HSPs)
chr4 (4-173)||(44507352-44507521)
chr4 (212-252)||(44507520-44507560)


Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 4 - 173
Target Start/End: Original strand, 44507352 - 44507521
Alignment:
4 taacaaagcaacaaaccattacattcgattaaactacacatgacaaagtattttgatcacgagtaacatagtgatacgtacggaatagggaattgagaaa 103  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44507352 taacaaagcaacaaaccattacattcgatgaaactacacatgacaaagtattttgatcacgagtaacatagtgatacgtacggaatagggaattgagaaa 44507451  T
104 tcgtttagaacatagccggagttgttaaggagaaacctcaattttatgccaaatagaacgataattaaat 173  Q
    |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| || |||||    
44507452 tcgtttagaacatagcaggagttgttaaggagaaacctcaatttaatgccaaatagaacgagaactaaat 44507521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 212 - 252
Target Start/End: Original strand, 44507520 - 44507560
Alignment:
212 atgagttttgatttcaaaacctacaagcaatgggaaccgat 252  Q
    |||||||||||||||||||||||||||||||||||||||||    
44507520 atgagttttgatttcaaaacctacaagcaatgggaaccgat 44507560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University