View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_high_107 (Length: 271)
Name: NF19103_high_107
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_high_107 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 65 - 177
Target Start/End: Original strand, 47348602 - 47348714
Alignment:
| Q |
65 |
gatcagaacctgaaaatttgttgaatgatggaacctcttaatggttggtgacgctcgctgtgccatgctcttcgaacacactcgtatggccttggccctg |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47348602 |
gatcagaacctgaaaatttgttgaatgatggaacctcttaatggttggtgacgctcgctgtgccatgctcttcgaacacactcgtatggccttggccctg |
47348701 |
T |
|
| Q |
165 |
gccgcggcatctt |
177 |
Q |
| |
|
||||||||||||| |
|
|
| T |
47348702 |
gccgcggcatctt |
47348714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 226 - 257
Target Start/End: Original strand, 47348763 - 47348794
Alignment:
| Q |
226 |
tatgggaagaaggaatggacacaaataattga |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47348763 |
tatgggaagaaggaatggacacaaataattga |
47348794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University