View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_high_130 (Length: 250)
Name: NF19103_high_130
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_high_130 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 52709557 - 52709322
Alignment:
| Q |
1 |
cctttatttcgactgactagtactttattttcatactccatttttctagtgaaactcaatggcgataatgacgtcttctttactctttatttatcaattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52709557 |
cctttatttcgactgactagtactttattttcatactccatttttctagtgaatctcaatggcgataatgacgtcttctttactctttatttatcaattt |
52709458 |
T |
|
| Q |
101 |
ttgatataagatcttgatttgtttatgaaaaaagccatatggtgcgaatcaaacaaactatcgtaaaaaagccacgaatgacctgagctttaatttttcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52709457 |
ttgatataagatcttgatttgtttatgaaaaaagccatatggtgcgaatcaaacaaactatcgtaaaaaacccacgaatgacctgagctttaatttttcg |
52709358 |
T |
|
| Q |
201 |
attcaaattctttagaaaatgaagttgcagcagccc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
52709357 |
attcaaattctttagaaaatgaagttgcagcagccc |
52709322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 154 - 242
Target Start/End: Original strand, 26398718 - 26398806
Alignment:
| Q |
154 |
caaactatcgtaaaaaagccacgaatgacctgagctttaatttttcgattcaaattctttagaaaatgaagttgcagcagccctatgct |
242 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26398718 |
caaactatcgtaaaaaatttacgaatgacctgagctttaatttttcaattcaaattctttagaaaatgaagttgccaaagccctatgct |
26398806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University