View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_high_134 (Length: 248)
Name: NF19103_high_134
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_high_134 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 134 - 248
Target Start/End: Complemental strand, 5010267 - 5010153
Alignment:
| Q |
134 |
catccaccacaacgacaatcattgaatcgagatcggatgatgaatatttgaaggttggattttgatttaaaaaagacaaaaacatatggttgaaatctgc |
233 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5010267 |
catccaccacaacgacaattattgcatcgagatcggaagatgaatatttgaaggttggattttgatttaaaaaagacaaaaacatatggttgaaatctgc |
5010168 |
T |
 |
| Q |
234 |
actgtctgtccgtgc |
248 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5010167 |
actgtctgtccgtgc |
5010153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University