View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_high_146 (Length: 240)
Name: NF19103_high_146
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_high_146 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 12149811 - 12149582
Alignment:
| Q |
1 |
acgaacattgtacacaattgttgtgggcaccggcatgtcccgg-------tgctatatagtttttagttaatgtgttgtgttttatattgcataggtgaa |
93 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12149811 |
acgaacattggacacaattgttgtgggcaccggcatgtcccggaccccggtgctatatagtttttagttaatgtgttgtgttttgtattgcataggtgaa |
12149712 |
T |
|
| Q |
94 |
acaattgttagnnnnnnntgatgaagggcatgttgttgctacttgccgtaatcctgatgcatcaactgggctacttcgtttgaaggatagatttgatgat |
193 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12149711 |
acaattgttagaaaaaaatgatgaagggcatgttgttgctacttgccgtaatcctgatgcatcaactgggctacttcgtttgaaggatagatttgatgat |
12149612 |
T |
|
| Q |
194 |
cgacttcaaattttgcctttggatttgact |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12149611 |
cgacttcaaattttgcctttggatttgact |
12149582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University