View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19103_high_150 (Length: 240)

Name: NF19103_high_150
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19103_high_150
NF19103_high_150
[»] chr8 (2 HSPs)
chr8 (125-240)||(38865880-38865995)
chr8 (1-75)||(38866040-38866114)


Alignment Details
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 125 - 240
Target Start/End: Complemental strand, 38865995 - 38865880
Alignment:
125 cacaagcacaagcactttttccgcacaaaagtacgtatagctgtagacaaatagtattacttagattacattacattagattgcagatcaaatttaatta 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38865995 cacaagcacaagcactttttccgcacaaaagtacgtatagctgtagacaaatagtattacttagattacattacattagattgcagatcaaatttaatta 38865896  T
225 gcttaaacattttgtc 240  Q
    ||||||||||||||||    
38865895 gcttaaacattttgtc 38865880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 38866114 - 38866040
Alignment:
1 ataattcttgtcttccgtggttactatactaattcacgatgtgccctactacttcatccaaattgccaagaagct 75  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
38866114 ataattcttgtcttccgtggttactatactaattcactatgtgccctactacttcatccaaattgccaagaagct 38866040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University