View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_high_170 (Length: 230)
Name: NF19103_high_170
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_high_170 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 5017496 - 5017722
Alignment:
| Q |
1 |
tcagacattcaatggtaatggctggcaagcatttcctgttgcatcggaagctactaccacagcaacacataacttagttcctaatatgttctaccatgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5017496 |
tcagacattcaatggtaatggctggcaagcatttcctgttgcatcggaagctactaccacagcaacacataacttagttcctaatatgttctaccatgct |
5017595 |
T |
|
| Q |
101 |
ggatacacatttcctggatttccaggtttgtatgcaactttttctcttcagatgacttgtccttactgggatatccaggattgaacataatgatctatac |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5017596 |
ggatacacatttcccggatttccaggtttgtatgcaactttttctcttcagatgacttgtccttactgggatttccaggattgaacataatgatctatac |
5017695 |
T |
|
| Q |
201 |
tgattgatatatcattttgtatgaact |
227 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
5017696 |
tgattgatatatcattttgtataaact |
5017722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 111 - 158
Target Start/End: Original strand, 5005614 - 5005661
Alignment:
| Q |
111 |
ttcctggatttccaggtttgtatgcaactttttctcttcagatgactt |
158 |
Q |
| |
|
||||||| ||||||||| |||||| ||||||||||||||| ||||||| |
|
|
| T |
5005614 |
ttcctggctttccaggtatgtatggaactttttctcttcatatgactt |
5005661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University