View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_high_171 (Length: 228)
Name: NF19103_high_171
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_high_171 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 36 - 210
Target Start/End: Original strand, 36210625 - 36210803
Alignment:
| Q |
36 |
ttacaacccggcccaagcacattgccacgtcataatgggaaaccatgcagagtcaacaaaaatcaacatta---atcatgcatgatattatgaaaacttg |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |||| || |||||||||||||||||||||||||| |
|
|
| T |
36210625 |
ttacaacccggcccaagcacattgccacgtcataatgtgaaaccatgcagagtcaacaatagtcaa-atgccacatcatgcatgatattatgaaaacttg |
36210723 |
T |
 |
| Q |
133 |
gtgagctgctcaatacttatttttacataactgatcttg---tgctgtgtcttcttttcttttttaaaatattggctattc |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36210724 |
gtgagctgctcaatactta-ttttacataagtgagcttgtgctgctgtgtcttcttttcttttttaaaatattggctattc |
36210803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University