View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_high_39 (Length: 409)
Name: NF19103_high_39
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_high_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 371; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 371; E-Value: 0
Query Start/End: Original strand, 18 - 396
Target Start/End: Original strand, 54637708 - 54638086
Alignment:
| Q |
18 |
ttttggagggaataaaagtctatgttttgtactgaattgcagttgcagcaagcaaggcaaaataatagtaatgtaatataagaggacaagtacaccgcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
54637708 |
ttttggagggaataaaagtctatgttttgtactgaaatgcagttgcagcaagcaaggcaaaataatagtaatgtaatataagaggacaagtacactgcaa |
54637807 |
T |
 |
| Q |
118 |
gacctatgcataccatttccattccatcccatccatattttactttgatattgtgaattgtagtcaatggcaggtgggagtaacatgatgagcaagattc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54637808 |
gacctatgcataccatttccattccatcccatccatattttactttgatattgtgaattgtagtcaatggcaggtgggagtaacatgatgagcaagattc |
54637907 |
T |
 |
| Q |
218 |
tattgatcggtggcaccggttacatcggaaaattcattgtagaagctagcgccaaagctggccatccaaccttccttctcatccgggaatcaactctttc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54637908 |
tattgatcggtggcaccggttacatcggaaaattcattgtagaagctagcgccaaagctggccatccaaccttccttctcatccgggaatcaactctttc |
54638007 |
T |
 |
| Q |
318 |
caaccctactaaatcatccatcatcaacaaattcaaggacttgtccgtcaattttgttcttgtgcgtcaaatcctattc |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54638008 |
caaccctactaaatcatccatcatcaacaaattcaaggacttgtccgtcaattttgttcttgtgcgtcaaatcctattc |
54638086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University