View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_high_78 (Length: 316)
Name: NF19103_high_78
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_high_78 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 10 - 219
Target Start/End: Complemental strand, 12812337 - 12812127
Alignment:
| Q |
10 |
attatactataattaaataggaaaaagagaataatataaaaattaagaataatttttgtttccannnnnnngtnnnnnnn-gttctcaagtgtgtgtgtc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| | |
|
|
| T |
12812337 |
attatactataattaaataggaaaaagagaataatataaaaattaagaataatttttgtttccatttttttgtaaaaaaaagttctcaagtgtgtgt--c |
12812240 |
T |
 |
| Q |
109 |
cctttttatatagcacacaaactttcatttctcactacaaaaatttatattctctc--tcnnnnnnnccatattgcactaaatcactataaataaagtta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
12812239 |
cctttttatatagcacacaaactttcatttctcactacaaaaatttatattctctctttttttttttccatattgcactaaatcactataaataaagtta |
12812140 |
T |
 |
| Q |
207 |
gagtttatttctt |
219 |
Q |
| |
|
||||||||||||| |
|
|
| T |
12812139 |
gagtttatttctt |
12812127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University