View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_high_96 (Length: 283)
Name: NF19103_high_96
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_high_96 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 264
Target Start/End: Original strand, 45969046 - 45969289
Alignment:
| Q |
17 |
caaataatgccttcagtattttataacttgtttaataccccaatggccaattggacaaatacttgtgatgactgatgaggagctcaatagttttgcatga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45969046 |
caaataatgccttcagtattttataacttgtttaatacctcaatggccaattgaacaaatacttgtgatgactgatgaggagctcaatagttttgcatga |
45969145 |
T |
|
| Q |
117 |
ccctgtgtttcatcaaaagatggccaatgccttttatgtaattaagtgcatgtgtatcccagagactggtcaatgaatttaagggatggagcaaaaaact |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45969146 |
ccctgtgtttcatcaaaagatggccaatgccttttatg----taagtgcatgtgtatcccaaagactggtccatgaatttaagggatggagcaaaaaact |
45969241 |
T |
|
| Q |
217 |
gcataaacatgatatgcaacagctcctcactcctcaccctgatggagc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45969242 |
gcataaacatgatatgcaacagctcctcactcctcaccctgatggagc |
45969289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University