View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_low_107 (Length: 271)
Name: NF19103_low_107
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_low_107 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 4 - 173
Target Start/End: Original strand, 44507352 - 44507521
Alignment:
| Q |
4 |
taacaaagcaacaaaccattacattcgattaaactacacatgacaaagtattttgatcacgagtaacatagtgatacgtacggaatagggaattgagaaa |
103 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44507352 |
taacaaagcaacaaaccattacattcgatgaaactacacatgacaaagtattttgatcacgagtaacatagtgatacgtacggaatagggaattgagaaa |
44507451 |
T |
|
| Q |
104 |
tcgtttagaacatagccggagttgttaaggagaaacctcaattttatgccaaatagaacgataattaaat |
173 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| || ||||| |
|
|
| T |
44507452 |
tcgtttagaacatagcaggagttgttaaggagaaacctcaatttaatgccaaatagaacgagaactaaat |
44507521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 212 - 252
Target Start/End: Original strand, 44507520 - 44507560
Alignment:
| Q |
212 |
atgagttttgatttcaaaacctacaagcaatgggaaccgat |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44507520 |
atgagttttgatttcaaaacctacaagcaatgggaaccgat |
44507560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University