View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19103_low_121 (Length: 254)

Name: NF19103_low_121
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19103_low_121
NF19103_low_121
[»] chr7 (1 HSPs)
chr7 (1-245)||(46905270-46905514)


Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 46905270 - 46905514
Alignment:
1 cgttatgactacgagaatattgattttggcaaacctttgcatactttatgttgttattctcttttttatagggtacgttcctttaatatggatatgatct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
46905270 cgttatgactacgagaatattgattttggcaaacctttgcatactttatgttgttattctcttttttatagggtacgttgctttaatatggatatgatct 46905369  T
101 taacacgaataacattgttgaatttccttaaaataaaaatgttgaattggtaatagtaatttatttatttttgaattattattggtaatagattaagtta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46905370 taacacgaataacattgttgaatttccttaaaataaaaatgttgaattggtaatagtaatttatttatttttgaattattattggtaatagattaagtta 46905469  T
201 attatcacactatcacatttaagatcatggttaatttagaattat 245  Q
    ||||||||||||||||||||||||||||||||||||| |||||||    
46905470 attatcacactatcacatttaagatcatggttaatttggaattat 46905514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University