View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_low_125 (Length: 251)
Name: NF19103_low_125
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_low_125 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 86 - 179
Target Start/End: Complemental strand, 40993535 - 40993442
Alignment:
| Q |
86 |
ttttggattaggtttcttttgatgttaaaataattaaataataaaaaacatacttgcttaaaggtgactaaattcaaatttcttctttttattc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40993535 |
ttttggattaggtttcttttgatgttaaaataattaaataataaaacacatacttgcttaaaggtgactaaattcaaatttcttctttttattc |
40993442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 87 - 179
Target Start/End: Original strand, 21182207 - 21182295
Alignment:
| Q |
87 |
tttggattaggtttcttttgatgttaaaataattaaataataaaaaacatacttgcttaaaggtgactaaattcaaatttcttctttttattc |
179 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| |||||| ||||||||||||||||||||| |||||||||| ||||| | |||||||| |
|
|
| T |
21182207 |
tttggattaagtttctcttgatgttaaaataatgaaataa----aaacatacttgcttaaaggtgcctaaattcaactttctccattttattc |
21182295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 200 - 241
Target Start/End: Complemental strand, 10693191 - 10693150
Alignment:
| Q |
200 |
gtaatagaaatagtttatacaagaaaatgatacgtacctatg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10693191 |
gtaatagaaatagtttatacaagaaaatgatacgtacctatg |
10693150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University