View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_low_134 (Length: 249)
Name: NF19103_low_134
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_low_134 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 13287495 - 13287736
Alignment:
| Q |
1 |
tccgtatccgtgctttcataggtagtaagtaataggaacttgacctttttcatgcgaactccttggaggctaagctccagttgactctctaggtcttgta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||||| |
|
|
| T |
13287495 |
tccgtatccgtgctttcataggtagtaagtaataggaacttgacctttttcatgcgaactccttgtaggctaagttccagctgactctctaggtcttgta |
13287594 |
T |
 |
| Q |
101 |
ggtttctgatactcaaaccataaagctgttctcccatcaactgcctatgagctcaaaatgttagtgttctcatacatggagcttaatgaatagaaatatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
13287595 |
ggtttctgatactcaaaccataaagctgttctcccatcaattgcctatgagctcaaaatgttagtgctctcatacaaggagcttaatgaatagaaatatt |
13287694 |
T |
 |
| Q |
201 |
g--aaaaaatgctgaatgaattagttgaaggttgtacctatg |
240 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13287695 |
gaaaaaaaatgctgaatgaattagttgaaggttttacctatg |
13287736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University