View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_low_135 (Length: 249)
Name: NF19103_low_135
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_low_135 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 24996662 - 24996904
Alignment:
| Q |
1 |
caaaccatatcaattatatgatgaccatggttcgccaatttatccgcacaaccattgcctgtcataaaaatgagagatgaaatcactcgaagactaagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||||| ||||||||| ||||||||||| |
|
|
| T |
24996662 |
caaaccatatcaattatatgatgaccatggttcgccaacttatccgcacaaccattgccttccatagaaatgagagataaaatcactcaaagactaagag |
24996761 |
T |
 |
| Q |
101 |
agatataatttgaaagcatttctagatttggaattgccaatttatgttatattccagcacaaaatcttcattgnnnnnnnttaaaaggatcaagaccctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
24996762 |
agatataatttgaaagcatttctagatttggaattgccaattgatgttatattccagc-caaaatcttcattgaaaaaaattaaaaggatcaagaccctt |
24996860 |
T |
 |
| Q |
201 |
aaaacgggtttggtaagctctattcaactttttcctttgcttct |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24996861 |
aaaacgggtttggtaagctctattcaactttttcctttggttct |
24996904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 77 - 143
Target Start/End: Complemental strand, 28293246 - 28293180
Alignment:
| Q |
77 |
atgaaatcactcgaagactaagagagatataatttgaaagcatttctagatttggaattgccaattt |
143 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
28293246 |
atgaaatcacttgaagactaagagagatacaatttgaaagcatttatagattcagaattgccaattt |
28293180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University