View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_low_142 (Length: 243)
Name: NF19103_low_142
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_low_142 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 46748266 - 46748461
Alignment:
| Q |
1 |
taactgacaaaattatatatcagacaagattcataatttgtgtcttttagctcaacttgtaaagtatttcgcatataattctgnnnnnnnntcaagcgac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46748266 |
taactgacaaaattatatatcagacaagattcataatttgtgtcttttagctcaacttgtaaagtatttcgcatataattctgaaaaaaaatcaagcgac |
46748365 |
T |
 |
| Q |
101 |
cagttttgttcctaaaaggtgatataaacaatatcttttggtaaaatnnnnnnncgaataatctgtaggtgagtgtgattgttggaatagggttta |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46748366 |
cagttttgttcctaaaaggtgatataaacaatatcttttggtaaaataaaaaaacgaataatctgtaggtgagtgtgattgttggaatagggttta |
46748461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University