View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_low_152 (Length: 240)
Name: NF19103_low_152
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_low_152 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 125 - 240
Target Start/End: Complemental strand, 38865995 - 38865880
Alignment:
| Q |
125 |
cacaagcacaagcactttttccgcacaaaagtacgtatagctgtagacaaatagtattacttagattacattacattagattgcagatcaaatttaatta |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38865995 |
cacaagcacaagcactttttccgcacaaaagtacgtatagctgtagacaaatagtattacttagattacattacattagattgcagatcaaatttaatta |
38865896 |
T |
|
| Q |
225 |
gcttaaacattttgtc |
240 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38865895 |
gcttaaacattttgtc |
38865880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 38866114 - 38866040
Alignment:
| Q |
1 |
ataattcttgtcttccgtggttactatactaattcacgatgtgccctactacttcatccaaattgccaagaagct |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38866114 |
ataattcttgtcttccgtggttactatactaattcactatgtgccctactacttcatccaaattgccaagaagct |
38866040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University