View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_low_158 (Length: 238)
Name: NF19103_low_158
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_low_158 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 4560050 - 4559827
Alignment:
| Q |
1 |
aaataaagggtcagggttattcattgaaccaacacatagactctccaaggcctgttatagtttcgaaggaaccattacatactctttcgaggtcnnnnnn |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4560050 |
aaataaagggtcatggttattcattgaaccaacacatagactctccaaggcctgttatagtttcgaaggaaccattacatactctttcgaggtcaaaaaa |
4559951 |
T |
 |
| Q |
101 |
ngcacattgggactctccgcggctctcttatgatgcattgaaatctactacaaggtataaggagcttcctaggctttccttggatagcaagcaaggatcc |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4559950 |
agcacattgggactctccgcgactctcttatgatgcattgaaatctactacaaggtataaggagcttcctaggctttccttggacagcaagcaaggatcc |
4559851 |
T |
 |
| Q |
201 |
attcgagggattgacggaggaaac |
224 |
Q |
| |
|
|||||||||||||||| ||||||| |
|
|
| T |
4559850 |
attcgagggattgacgaaggaaac |
4559827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University