View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_low_160 (Length: 238)
Name: NF19103_low_160
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_low_160 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 18 - 130
Target Start/End: Original strand, 1504411 - 1504526
Alignment:
| Q |
18 |
atttcccttttcttacccactcctacaaccatgcaagagtcacaa---ctcttgggttagggccagagccatatcattatcatgcatatatacctttatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1504411 |
atttcccttttcttacccactcctacaatcatgcaagagtcacaacaactcttgggttagggccagagccatatcattatcatgcatatatacctttatt |
1504510 |
T |
|
| Q |
115 |
tccatcacacatgttc |
130 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
1504511 |
tccatcacacatgttc |
1504526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 171 - 238
Target Start/End: Original strand, 1504527 - 1504590
Alignment:
| Q |
171 |
catatgatatatctctcatacatagagagtattatgtaaatattttttcaaaatataactacacttat |
238 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1504527 |
catatgatatatctctcata----gagagtattatgtaaatattttttcaaaatataactacacttat |
1504590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University