View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_low_165 (Length: 236)
Name: NF19103_low_165
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_low_165 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 1504633 - 1504712
Alignment:
| Q |
1 |
tttctggttccgtccttgtctaaaagcatatagcatcgagcattataactcgcaaagttagagatatttatttagtcttg |
80 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1504633 |
tttctggatccgtccctgtctaaaagcatatagcatcgagcattataactcgcaaagttagagatattaatttagtcttg |
1504712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 144 - 236
Target Start/End: Original strand, 1504775 - 1504867
Alignment:
| Q |
144 |
gtgttccacctaatataaattttctttttgttagcttnnnnnnnntccaacacgccatcaaatatctagattcagtacgaaacatcttttctt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1504775 |
gtgttccacctaatataaattttctttttgttagcttaaaaaaaatccaacatgccatcaaatatctagattcagtacgaaacatctattctt |
1504867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University