View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_low_176 (Length: 223)
Name: NF19103_low_176
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_low_176 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 14 - 206
Target Start/End: Complemental strand, 52584904 - 52584712
Alignment:
| Q |
14 |
agaatatatactatactagcttttttgctcaaatagtttcttcagtacgtaaaaaacagtgttgattcgattcgattcgattccccctttcactcctttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584904 |
agaatatatactatactagcttttttgctcaaatagtttcttcagtacgtaaaaaacagtgttgattcgattcgattcgattccccctttcactcctttt |
52584805 |
T |
|
| Q |
114 |
ctctttttccataaaaatctctcttctttcactgttctagagagatccacatcacaaaactcacatgcttcatttttccaattgagttgttcc |
206 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584804 |
ctccttttccataaaaatctctcttctttcactgttctagagagatccacatcacaaaactcacatgcttcatttttccaattgagttgttcc |
52584712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University