View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_low_181 (Length: 218)
Name: NF19103_low_181
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_low_181 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 19 - 203
Target Start/End: Complemental strand, 6972564 - 6972380
Alignment:
| Q |
19 |
aactataatataataagttcgagaaggtttgatttctgattgtccccttttaaccgtaataaaaagtatgtatcataactctcatccattttaactcgtg |
118 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6972564 |
aactataacataataggttcgagaaggtttgatttctgattgtcccattttaaccgtaataaaaagtatgtatcataactctcatccattttaactcgtg |
6972465 |
T |
 |
| Q |
119 |
aacccgatcaaacctgaccgtttgcttgttgaaccatcatatttgggtgggtttgatcgattcaatgtattgtgccacccctatg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6972464 |
aacccgatcaaacctgaccgtttgcttgttcaaccatcatatttgggtgggtttgatcgattcaatgtattgtgccacccctatg |
6972380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University