View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19103_low_187 (Length: 203)

Name: NF19103_low_187
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19103_low_187
NF19103_low_187
[»] chr5 (1 HSPs)
chr5 (1-137)||(34508828-34508960)


Alignment Details
Target: chr5 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 34508960 - 34508828
Alignment:
1 ttaatctgttttatttttaattgtatgctatttctttaatttcaaaatatgggtttggttctctctctgtttcatgaggttcgtgagttttttcttaagg 100  Q
    ||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||  |||||||||||||||||||||||  ||||||    
34508960 ttaatttgttttatttttaattctatgctatttctttaatttcaaaatatgggtttggttctgtctc--tttcatgaggttcgtgagttttt--ttaagg 34508865  T
101 attcatgaggttcataagttaacattaaattgcttaa 137  Q
    || || ||| ||||| |||||||||||||||||||||    
34508864 atccacgagattcatgagttaacattaaattgcttaa 34508828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University