View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_low_187 (Length: 203)
Name: NF19103_low_187
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_low_187 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 34508960 - 34508828
Alignment:
| Q |
1 |
ttaatctgttttatttttaattgtatgctatttctttaatttcaaaatatgggtttggttctctctctgtttcatgaggttcgtgagttttttcttaagg |
100 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
34508960 |
ttaatttgttttatttttaattctatgctatttctttaatttcaaaatatgggtttggttctgtctc--tttcatgaggttcgtgagttttt--ttaagg |
34508865 |
T |
 |
| Q |
101 |
attcatgaggttcataagttaacattaaattgcttaa |
137 |
Q |
| |
|
|| || ||| ||||| ||||||||||||||||||||| |
|
|
| T |
34508864 |
atccacgagattcatgagttaacattaaattgcttaa |
34508828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University