View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_low_48 (Length: 395)
Name: NF19103_low_48
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_low_48 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 41 - 385
Target Start/End: Complemental strand, 42038920 - 42038576
Alignment:
| Q |
41 |
gttaaccctccgattcttagggggaagggacattagtaattcaaatgccgtggggtaattatagtcttgtcaagaattgttttacacttaaatcaaactc |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038920 |
gttaaccctccgattcttagggggaagggacattagtaattcaaatgccgtgtggtaattatagtcttgtcaagaattgttttacacttaaatcaaactc |
42038821 |
T |
 |
| Q |
141 |
aaggttctccaaaatgaatcgtcttttggtggaactaattaaccacatgagcctaattcattggtttttggtgttgattgttatacaatgtattatgtaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038820 |
aaggttctccaaaatgaatcgtcttttggtggaactaattaaccacatgagcctaattcattggtttttggtgttgattgttatacaatgtattatgtaa |
42038721 |
T |
 |
| Q |
241 |
tctacaaaggatccaccattaatcaatattataatagggtataccaaattaagagcaaaaacaatagtaaaggttgcactcgggacaacctacttacgct |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42038720 |
tctacaaaggatccaccattaatcaatattataataggttataccaaattaagagcaaaaacaatagtaaaggtcgcactcgggacaacctacttacgct |
42038621 |
T |
 |
| Q |
341 |
tagaatgtttatttaagcttgtgaatactggttgtgttttctgtg |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038620 |
tagaatgtttatttaagcttgtgaatactggttgtgttttctgtg |
42038576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University