View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_low_53 (Length: 381)
Name: NF19103_low_53
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_low_53 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 7e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 1 - 163
Target Start/End: Original strand, 42207052 - 42207214
Alignment:
| Q |
1 |
aagatgagagtggaattgaattgagtaaagaggatgccattgatgcttctgcttagaagaagaagaagatgaagtgttagcgaaagaacggatnnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42207052 |
aagatgagagtggaattgaattgagtaaagaggatgccattgatgcttctgcttaggagaagaagaagatgaactgttagcgaaagaacggataaaaaaa |
42207151 |
T |
 |
| Q |
101 |
ngatagagtcagataaggccaactcagtgcgtgcacacagcgcagtgtagaattcactcggta |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42207152 |
agatagagtcagataaggccaactcagtgcgtgcacacagcgcagtgtagaattcactcggta |
42207214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 291 - 362
Target Start/End: Original strand, 42207298 - 42207369
Alignment:
| Q |
291 |
gttttgtcaataacccgtctaataggaataggccacaagagatgtagggttcaaaatcttaccataccctgt |
362 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42207298 |
gttttgtcaataactcgtctaaaaggaataggccacaagagatgtagggttcaaaatcttaccataccctgt |
42207369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University