View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_low_58 (Length: 372)
Name: NF19103_low_58
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_low_58 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 13 - 357
Target Start/End: Complemental strand, 30715624 - 30715280
Alignment:
| Q |
13 |
gaaaaattggtaaaggagcgattggtatgtatgaagatgcattcatgggttgtgtgggatttgggacattataagaagaaactgaagggctttctggaac |
112 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30715624 |
gaaaaattggtaaaggagcgatttgtatgtatgaagatgcattcatgggttgtgtgggatttcggacattataagaagaaactgaagggctttctggaac |
30715525 |
T |
|
| Q |
113 |
attgccaatgtgtgcttcttgtgagaaagatggtttaccatgtggtgcattggacaaggattcagaaacatcatcgtcatcgtcatcattgtcttcttcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30715524 |
attgccaatgtgtgcttcttgtgagaaagatggtttaccatgtggtgcattggacaaggattcagaaacatcatcgtcatcgtcatcattgtcttcttcc |
30715425 |
T |
|
| Q |
213 |
tctttttcggtttcatcttcaaattgtcggtgttgatcctcttgagatttagaatccacatcgtttgcatcagtactattattatcgttgtcctcgtctt |
312 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30715424 |
tcttcttcggtttcatcttcaaactgtcggtgttgatcctcttgagattcagaatccacatcgtctgcatcagtactattattatcgttgtcctcgtctt |
30715325 |
T |
|
| Q |
313 |
tgtattcttctgataacttttgttttggaattctattatgatgtt |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30715324 |
tgtattcttctgataacttttgttttggaattctattatgatgtt |
30715280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University