View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19103_low_93 (Length: 292)
Name: NF19103_low_93
Description: NF19103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19103_low_93 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 21 - 284
Target Start/End: Original strand, 55370012 - 55370275
Alignment:
| Q |
21 |
gggagatgcaagcacatagaggtcaagtttcacttccttagagatcaagtcaacacgggaaggatcactctaagctactgtaagactgatgatcaagctg |
120 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55370012 |
gggagatgcaagcacattgaggtcaagtttcacttccttagagatcaagtcaacacgggaaggatcactctaagctactgtaagactgatgatcaagctg |
55370111 |
T |
 |
| Q |
121 |
cagatgttcttaccaagccattgaagatagaaaagttcaaagacatgaggaagatgcatgtgattagcctagataatttgaaataagcgggagtgttgaa |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
55370112 |
cagatgttcttaccaagccattgaagatagaaaagttcaaagacatgaggaagatgcatgtgattagcctagagaatttgaaataagcgggagtgttgaa |
55370211 |
T |
 |
| Q |
221 |
gtgtaattcaaattagatatatttgtataggctaagaatggggtatgtgtgttaaattagttgt |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
55370212 |
gtgtaattcaaattagatatatttgtataggctaagaatcgggtatgtgtgttaaattagttgt |
55370275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University