View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19104_high_26 (Length: 352)
Name: NF19104_high_26
Description: NF19104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19104_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 20 - 341
Target Start/End: Complemental strand, 35285454 - 35285133
Alignment:
| Q |
20 |
cctaatttatatcattctcttctctgttcttatctcaaatgaaccaccacttcttattcctcaatccaatattccacctgcaactttaaaattcctccca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35285454 |
cctaatttatatcattctcttctctgttcttatctcaaatgaaccaccacttcttattcctcaatccaatattccacctgcaactttaaaattcctccca |
35285355 |
T |
|
| Q |
120 |
tccattcaaccagaacaaacgaacatnnnnnnnnnnnntgcggttcaaccttttgaacccatcccattccattcatttgctgagagggccgaaggaagat |
219 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35285354 |
tccattcaaccagaacaaacgaacataaaaaagaaaaatgcggttcaaccttttgaacccatctcattcaattcatttgctgagagggccgaaggaagat |
35285255 |
T |
|
| Q |
220 |
gatatgtgcttaaacttctggttctttctttagaaaagaaacatacggttcaaccttttgaaccgggcggttcgtcgagttcctggttttgccggttttc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35285254 |
gatatgtgcttaaacttctggttctttctttagaaaagaaacatacggttcaaccttttgaaccgggcggttcgtcgagttcctggttttgccggttttc |
35285155 |
T |
|
| Q |
320 |
agtcggttttcttgtttcctat |
341 |
Q |
| |
|
| |||||||||||||||||||| |
|
|
| T |
35285154 |
actcggttttcttgtttcctat |
35285133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University