View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19104_high_34 (Length: 297)
Name: NF19104_high_34
Description: NF19104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19104_high_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 8e-58; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 113 - 285
Target Start/End: Complemental strand, 48561744 - 48561578
Alignment:
| Q |
113 |
cctgttagtagtaacaatttattggcagaagttaaactcaactgtctatctagaataagaaaggcaattagt---agtaactaatggtatccaaccgaac |
209 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
48561744 |
cctgttagtaataacaatttattggcagaagttaaactcaactgtctatctagaataagaaaggcaattagtagtagtaactaatgctatccaaccg--- |
48561648 |
T |
 |
| Q |
210 |
cccaacaacaccaactataataacaagaagaataattaactttttacacgggtagtgtaacgtttgtagtaatatt |
285 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48561647 |
------aacaccaactataataacaacaagaataatttactttttacacgggtagtgtaacgtttgtagtaatatt |
48561578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 2 - 49
Target Start/End: Complemental strand, 48561856 - 48561809
Alignment:
| Q |
2 |
acgattgatacggcggtaatgttatttataatctaccaacatagattg |
49 |
Q |
| |
|
||||| |||||||||| ||||||||||| ||| ||||||||||||||| |
|
|
| T |
48561856 |
acgatagatacggcggcaatgttatttacaatttaccaacatagattg |
48561809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University