View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19104_high_47 (Length: 266)

Name: NF19104_high_47
Description: NF19104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19104_high_47
NF19104_high_47
[»] chr5 (1 HSPs)
chr5 (209-256)||(1242489-1242536)
[»] chr8 (1 HSPs)
chr8 (209-256)||(473044-473091)


Alignment Details
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 209 - 256
Target Start/End: Complemental strand, 1242536 - 1242489
Alignment:
209 aggtccgataggtttcaaaatgggaggccttgctttgtttttcctatg 256  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
1242536 aggtccgataggtttcaaaatgggaggccttgctttgtttttcctatg 1242489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 209 - 256
Target Start/End: Complemental strand, 473091 - 473044
Alignment:
209 aggtccgataggtttcaaaatgggaggccttgctttgtttttcctatg 256  Q
    |||||||||||||||||||||||||| |||| |||| ||||| |||||    
473091 aggtccgataggtttcaaaatgggagaccttactttcttttttctatg 473044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University