View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19104_high_47 (Length: 266)
Name: NF19104_high_47
Description: NF19104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19104_high_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 209 - 256
Target Start/End: Complemental strand, 1242536 - 1242489
Alignment:
| Q |
209 |
aggtccgataggtttcaaaatgggaggccttgctttgtttttcctatg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1242536 |
aggtccgataggtttcaaaatgggaggccttgctttgtttttcctatg |
1242489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 209 - 256
Target Start/End: Complemental strand, 473091 - 473044
Alignment:
| Q |
209 |
aggtccgataggtttcaaaatgggaggccttgctttgtttttcctatg |
256 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||| ||||| ||||| |
|
|
| T |
473091 |
aggtccgataggtttcaaaatgggagaccttactttcttttttctatg |
473044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University