View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19104_high_50 (Length: 261)
Name: NF19104_high_50
Description: NF19104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19104_high_50 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 45588294 - 45588408
Alignment:
| Q |
1 |
ttttgtctctaaagtgaaaagttattaggattaactttct---------atttttcttataaaaaataacgaggtaacataaactagttaaaaatcaatt |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45588294 |
ttttgtctctaaagtgaaaagttattaggattaactttctcaaaaatctatttttcttattaaaaataacgaggtaacataaactagttaaaaatcaatt |
45588393 |
T |
|
| Q |
92 |
tttgttaacgattga |
106 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
45588394 |
tttgttaacgattga |
45588408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 197 - 254
Target Start/End: Original strand, 45588498 - 45588555
Alignment:
| Q |
197 |
tgtaattggttgttgtcatttctgttacaggaacttaacttggatggcttcatatcac |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45588498 |
tgtaattggttgttgtcatttctgttacaggaacttaacttggatggcttcatatcac |
45588555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University