View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19104_high_52 (Length: 253)
Name: NF19104_high_52
Description: NF19104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19104_high_52 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 17 - 197
Target Start/End: Original strand, 50106367 - 50106546
Alignment:
| Q |
17 |
agattattataggttggtatcatcttgctcttttattctcggacaatactaaaatcgatannnnnnnaagggaaatactttaaatgcatgacatctttgt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| ||||||||||||| |||||||| |
|
|
| T |
50106367 |
agattattataggttggtatcatcttgctcttttattctcggacaatactaaaatggatattttttgaagggaaata-tttaaatgcatgatatctttgt |
50106465 |
T |
|
| Q |
117 |
cgtcatatttgcacgaatagcttggtaatgccatttgatcgttctttcttagttaacttttttaccaaaatgaccatttaa |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50106466 |
cgtcatatttgcacgaatagcttggtaatgccatttgattgttctttcttagttaacttttttaccaaaatgaccatttaa |
50106546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 199 - 246
Target Start/End: Original strand, 50106585 - 50106632
Alignment:
| Q |
199 |
attttttctagagggaattataaattacggcttactatatcttctgtg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50106585 |
attttttctagagggaattataaattacggcttactatatcttgtgtg |
50106632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 101 - 155
Target Start/End: Complemental strand, 15931702 - 15931649
Alignment:
| Q |
101 |
tgcatgacatctttgtcgtcatatttgcacgaatagcttggtaatgccatttgat |
155 |
Q |
| |
|
|||||||||| |||||| | ||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
15931702 |
tgcatgacatatttgtccttatatttgcacgaataacttggtaat-ccatttgat |
15931649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University