View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19104_high_58 (Length: 249)
Name: NF19104_high_58
Description: NF19104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19104_high_58 |
 |  |
|
| [»] scaffold0115 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0115 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: scaffold0115
Description:
Target: scaffold0115; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 13 - 98
Target Start/End: Original strand, 35186 - 35271
Alignment:
| Q |
13 |
aatatgcttcgtcacacattgataacttcaatctacacaccattggtgttctaactagcttgcaactattcctcttgtatatatct |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35186 |
aatatgcttcgtcacactttgataacttcaatcaacacaccattggtgttctaactagcttgcaactatacctcttgtatatatct |
35271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0115; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 145 - 234
Target Start/End: Original strand, 35280 - 35368
Alignment:
| Q |
145 |
ttggtgtcttcatataagtggattgtgttggtcatgagattacttgttgaacttctctagatgattcttattccaattcaggaaagacat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
35280 |
ttggtgtcttcatataagtggattgtgttgatcatgagattacttgttgaacttctcta-acgattcttattccaattcaggaaagacat |
35368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University