View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19104_high_70 (Length: 228)
Name: NF19104_high_70
Description: NF19104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19104_high_70 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 19 - 210
Target Start/End: Complemental strand, 38272767 - 38272576
Alignment:
| Q |
19 |
gaagtaccctttaccctacgttgcttgagagccctgaattaagatggcccttcgtacgtaaggtatactccatcctcacctttcagttgcttctcaccat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38272767 |
gaagtaccctttaccctacgttgcttgagagccctgaattaagatggcccttcatacttaaggtatactccatcctcacctttcagttgcttctcaccat |
38272668 |
T |
 |
| Q |
119 |
tgccgttgcctcagtcgttgttttcgttcaccccgttgctaatttcttcgtccactccaaactaggctatgctctttacattgtccttctct |
210 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38272667 |
tgccgttgcctcagtagttgttttcgttcaccccgttgctaatttcttcgtcaactccaaactaggctatgctctttacattgtccttctct |
38272576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 24 - 147
Target Start/End: Complemental strand, 38314881 - 38314758
Alignment:
| Q |
24 |
accctttaccctacgttgcttgagagccctgaattaagatggcccttcgtacgtaaggtatactccatcctcacctttcagttgcttctcaccattgccg |
123 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||||||| || |||||| |||| |||||||||||||||||| |||| | |
|
|
| T |
38314881 |
accctttaccctacgatgcttgagagccctgaactaagatggtccttcatacgtaaggtttattccatcatcacttttcagttgcttctcaccgttgctg |
38314782 |
T |
 |
| Q |
124 |
ttgcctcagtcgttgttttcgttc |
147 |
Q |
| |
|
||||||| |||||||||||||||| |
|
|
| T |
38314781 |
ttgcctccgtcgttgttttcgttc |
38314758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 19 - 205
Target Start/End: Complemental strand, 38276481 - 38276295
Alignment:
| Q |
19 |
gaagtaccctttaccctacgttgcttgagagccctgaattaagatggcccttcgtacgtaaggtatactccatcctcacctttcagttgcttctcaccat |
118 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||| ||||| |||||||||||||||||||| |||| ||||||||||||| ||| |
|
|
| T |
38276481 |
gaagtgccctttaccctacgatgcttgagagccctgaattaagatggtccttcatacgtaaggtatactccatcatcacaattcagttgcttctgggcat |
38276382 |
T |
 |
| Q |
119 |
tgccgttgcctcagtcgttgttttcgttcaccccgttgctaatttcttcgtccactccaaactaggctatgctctttacattgtcct |
205 |
Q |
| |
|
|| ||||| | | | || |||| ||||| ||| |||||||||||||| || ||||||||||| || ||| |||| ||||||||| |
|
|
| T |
38276381 |
cgctgttgcattcgccattatttttgttcatcccattgctaatttcttcttcaactccaaactaagccatgttcttcgcattgtcct |
38276295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 26 - 115
Target Start/End: Complemental strand, 38304397 - 38304308
Alignment:
| Q |
26 |
cctttaccctacgttgcttgagagccctgaattaagatggcccttcgtacgtaaggtatactccatcctcacctttcagttgcttctcac |
115 |
Q |
| |
|
||||||||||||| | ||||| | |||||||||||||| | ||||| | |||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
38304397 |
cctttaccctacgatacttgaaaaccctgaattaagattgtccttcattcgtaaggtttattccatcctcacctttcagttgcttctcac |
38304308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University