View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19104_high_74 (Length: 219)
Name: NF19104_high_74
Description: NF19104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19104_high_74 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 11 - 185
Target Start/End: Complemental strand, 660403 - 660229
Alignment:
| Q |
11 |
ggtagattatactgcatgggtttatccctttgaagttgctttcatgcactcttctacaaataggaaactctacattgtggacaatattgttgatcttttc |
110 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
660403 |
ggtagcttattctgcatgggtttatccctttgaagttgctttcatgcactcttctacaaataggaaactctacattgtggacaatattgttgatcttttc |
660304 |
T |
 |
| Q |
111 |
ttcgctgttgatattgttttgacattcttcgtcgcatacgttgatggaacaactcatctacttgtcagagattcc |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
660303 |
ttcgctgttgatattgttttgacattcttcgtcgcatacgtagatggaacaactcatctacttgtcagagattcc |
660229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University