View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19104_high_76 (Length: 213)
Name: NF19104_high_76
Description: NF19104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19104_high_76 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 16 - 199
Target Start/End: Original strand, 41986448 - 41986635
Alignment:
| Q |
16 |
gaacatcagtgaaggccttgttaaaaagtaaaaactatagatgaagaactagctgcacataatatttgtcatcctattgttccttttgtatggtgaggaa |
115 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41986448 |
gaacatcagtggaggccttgttaaaaagtaaaaactatagatgaagaactagctgcacataatatttgtcatcctattgttccttttgtatggtgaggaa |
41986547 |
T |
 |
| Q |
116 |
ggtgcta----tatctatgaggtgatatggggattgttcatattaagaaacagtatgatttattttggtaagtttaagtagaagctga |
199 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41986548 |
ggtgctatagctagctatgaggtgatatggggattgttcatattaagaaacagtatgatttattttggtaagtttaagtagaagctga |
41986635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University