View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19104_low_37 (Length: 292)
Name: NF19104_low_37
Description: NF19104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19104_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 18 - 275
Target Start/End: Original strand, 45587854 - 45588111
Alignment:
| Q |
18 |
attttgaaaggcaaaaccattacgggatcactatttggaggcttgaaaccaaaatctgatctccccctccttgctcagaagtacttagacaaagtaagtg |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45587854 |
attttaaaaggcaaaaccattacgggatcactatttggaggcttgaaaccaaaatctgatctccccctccttgctcagaagtacttagacaaagtaagtg |
45587953 |
T |
 |
| Q |
118 |
ctctatgtatctttggttccaatttaaggagaatttagaggtgcaaaattgatttatatctttaaaatgttatggagaaaattgattttgactctacaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45587954 |
ctctatgtatctttggttccaatttaaggagaatttagaggtgtaaaattgatttatatctttaaaatgttatggagaaaattgattttgactctacaat |
45588053 |
T |
 |
| Q |
218 |
cgattaatcttaaatatatttttaaattcacttgtacatgaatgaatattattcaaat |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45588054 |
cgattaatcttaaatatatttttaaattcacttgtacatgaatgaatattattcaaat |
45588111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University