View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19104_low_43 (Length: 276)
Name: NF19104_low_43
Description: NF19104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19104_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 42217099 - 42216828
Alignment:
| Q |
1 |
tcaccctcattgccttaattgtaattattatttatcaggtcaaaccctaaaccctataactcattctttccccctttttatttttagtcaacttgaatcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42217099 |
tcaccctcattgccttaattgtaattattatttatcaggtcaaaccctaaaccctataactcattctttccccctttttatttttagtcaacttgaatcg |
42217000 |
T |
|
| Q |
101 |
ccccatgatctaaagctttgtttttt-agcttaataattcaactgggtatctatgatatattgattttgatctattgcatattcaaatgctaactttgtt |
199 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42216999 |
ccccatgatgtaaagctttgtttttttagcttaataattcaactgggtatctatgatatattgattttgatctattgcatattcaaatgctaactttgtt |
42216900 |
T |
|
| Q |
200 |
ttacattttttattatttcagttaatgtgcttggcagaccttgaatttgattatataaatccctatgcttct |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
42216899 |
ttacattttttattatttcagttaatgtgcttggcagaccttgaatttgattatataaatccttatgattct |
42216828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University