View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19104_low_46 (Length: 269)
Name: NF19104_low_46
Description: NF19104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19104_low_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 12 - 253
Target Start/End: Complemental strand, 22122674 - 22122433
Alignment:
| Q |
12 |
atgaatttagtcatagcagttgtatcttccattaggtctgcagtgtttaagcagaatgaaattccatcttttgtcatttgaactgagcaatctataatat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22122674 |
atgaatttagtcatagcagttgtatcttccattaggtctgcagtgtttaagcagaatgaagttccatcttttgtcatttgaactgagcaatctataatat |
22122575 |
T |
 |
| Q |
112 |
cagctccatcatctattgcttgctgataagcaagatcagtggaacctggatatacaccacttgctccattattgcttatgatcaaagcttgtcctgaaaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22122574 |
cagctccatcatctattgcttgctgataagcaagatcagtggaacctggatatacaccacttgctccattattgcttatgatcaaagcttgtcctgaaaa |
22122475 |
T |
 |
| Q |
212 |
agaaaatgcattaggttagcttcttattttcatgctttgctg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22122474 |
agaaaatgcattaggttagcttcttattttcatgctttgctg |
22122433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 71 - 193
Target Start/End: Original strand, 54812355 - 54812477
Alignment:
| Q |
71 |
aattccatcttttgtcatttgaactgagcaatctataatatcagctccatcatctattgcttgctgataagcaagatcagtggaacctggatatacacca |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||| ||||| ||| ||||||||||| |||||||||||| ||||| || |||||| |
|
|
| T |
54812355 |
aattccatcttttgtcatttgaactgagcaatctatgatgtcagcgccatcggttatagcttgctgatatgcaagatcagtgctgcctgggtaaacacca |
54812454 |
T |
 |
| Q |
171 |
cttgctccattattgcttatgat |
193 |
Q |
| |
|
|||| ||| || |||||||||| |
|
|
| T |
54812455 |
cttgatccgttgctgcttatgat |
54812477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University