View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19104_low_62 (Length: 249)
Name: NF19104_low_62
Description: NF19104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19104_low_62 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 8408198 - 8408436
Alignment:
| Q |
1 |
cttatcttaagttttgtttgggtgactgttcagttatgtaacaagagaggaacttagacaagccttggctgaatatcaaatgggagatgaagcaactata |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8408198 |
cttaccttaagttttgtttgggtgactgttcagttatgtaacaagagaggaacttagacaagctttggctgaatatcaaatgggagatgaagcaactata |
8408297 |
T |
|
| Q |
101 |
gatgaagtcattgatgatgttgacaccgacaatgtatgtcacatatactatactattgagtattgacctttaataagtgcttctctatgtgaattgctac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8408298 |
gatgaagtcattgatgatgttgacaccgacaatgtatgtcacatatactatactattgagtattgaccttttataagtgcttctctatgtgaattgctac |
8408397 |
T |
|
| Q |
201 |
ttatggttgagctttcttatttgcaggatggcagaatta |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8408398 |
ttatggttgagctttcttatttgcaggatggcagaatta |
8408436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University