View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19104_low_63 (Length: 246)
Name: NF19104_low_63
Description: NF19104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19104_low_63 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 49 - 229
Target Start/End: Complemental strand, 6198437 - 6198256
Alignment:
| Q |
49 |
agatcaattcaaatgcaataatttatggtctagtatggatcagnnnnnnng-agactcattttatacacaacccatctaatcgtatataacggattgcgt |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |||||||||||| |||||| |
|
|
| T |
6198437 |
agatcaattcaaatgcaataatttatggtctagtatggatttttttttttttagactcattttatacgcaacccatctaaccgtatataacgggttgcgt |
6198338 |
T |
|
| Q |
148 |
atagaatggacttgtgaaaaatattgatcaatgatggatccaaattatttatctttagattaatcaaatctaccaatagtat |
229 |
Q |
| |
|
|||||||||||| ||||||||||| |||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6198337 |
atagaatggactcgtgaaaaatatagatccataatggatccaaattatttatctttagattaatcaaatctaccaatagtat |
6198256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University