View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19104_low_79 (Length: 213)

Name: NF19104_low_79
Description: NF19104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19104_low_79
NF19104_low_79
[»] chr1 (1 HSPs)
chr1 (16-199)||(41986448-41986635)


Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 16 - 199
Target Start/End: Original strand, 41986448 - 41986635
Alignment:
16 gaacatcagtgaaggccttgttaaaaagtaaaaactatagatgaagaactagctgcacataatatttgtcatcctattgttccttttgtatggtgaggaa 115  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41986448 gaacatcagtggaggccttgttaaaaagtaaaaactatagatgaagaactagctgcacataatatttgtcatcctattgttccttttgtatggtgaggaa 41986547  T
116 ggtgcta----tatctatgaggtgatatggggattgttcatattaagaaacagtatgatttattttggtaagtttaagtagaagctga 199  Q
    |||||||    || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41986548 ggtgctatagctagctatgaggtgatatggggattgttcatattaagaaacagtatgatttattttggtaagtttaagtagaagctga 41986635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University