View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19105_high_20 (Length: 268)
Name: NF19105_high_20
Description: NF19105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19105_high_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 44622520 - 44622269
Alignment:
| Q |
1 |
ttataagagtctggtgcctgaaggaatttaatttcgggttcattaaggatttttggattgatttaaaagatgatatattatgcattttttattagaattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44622520 |
ttataagagtctggtgcctgaaggaatttaatttctggttcattaaggatttttggattgatttaaaagatgatatattatgcattttttattagaattt |
44622421 |
T |
|
| Q |
101 |
cattggaatgaagagctaacgaaaggaattaatagtattttcatcgctttcaacggttagctaattttcgccctatatctttggtgggctgcttgtataa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44622420 |
cattggaatgaagagctaacgaaaggaattaatagtatttttatcgctttcaacggttagctaattttcgccctatatctttggtgggctgcttgtataa |
44622321 |
T |
|
| Q |
201 |
ggtattgtttaaggtgttaagaaaccgattgagaagtatgatgggcaatata |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44622320 |
ggtattgtttaaggtgttaagaaaccgattgagaagtatgatgggcaatata |
44622269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 73
Target Start/End: Complemental strand, 34977837 - 34977769
Alignment:
| Q |
4 |
taagagtctggtgcctgaaggaatttaatttcgggttcattaaggatttttggattgatttaaaagatga |
73 |
Q |
| |
|
||||||||||| |||||| |||||| ||||| || ||||| |||||||||||| | |||||||| ||||| |
|
|
| T |
34977837 |
taagagtctggggcctgacggaatt-aattttggtttcatcaaggatttttggctcgatttaaaggatga |
34977769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University